rs75694675 chr14:97978520 C>G
- Sequence
aaaacacaggtctcggctgccttg[C/G]tatcttcctgggcttcgagaatat
- ASB in cell types
- THP-1 (acute monocytic leukemia) epidermal keratinocytes
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| THP-1 (acute monocytic leukemia) | 2.12 | -1.78 | 1.00 | |||
| epidermal keratinocytes | 1.77 | -0.36 | 2.00 |
Items per page:
1 – 2 of 2