rs757369 chr14:68506829 A>G
- Sequence
ttttgtgcttgggtatgtgtgcac[A/G]catggtaggcgcccacactcaagt
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) GM12890 (Lymphoblastoid Cell Lines) GM19240 (B cells Lymphoblastoid Cell Lines) GM01310 ( Transformed lymphovlasoid cell line )
- ASB for transcription factors
- STAG1_HUMAN EP300_HUMAN NFAC3_HUMAN ARNT_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | -0.19 | 1.75 | 1.04 | n/a | n/a | |||
| EP300_HUMAN | -0.62 | 1.82 | 1.00 | n/a | n/a | |||
| NFAC3_HUMAN | -2.40 | 2.75 | 1.00 | n/a | No Hit | |||
| ARNT_HUMAN | -2.23 | 2.58 | 1.00 | 4.03 | Concordant | |||
| CTCF_HUMAN | -0.01 | 1.48 | 1.00 | n/a | No Hit |
Items per page:
1 – 5 of 7
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, alzheimers disease, aortic valve calcium, cystatin c in serum, fasting blood glucose, fetal hemoglobin level (the proportion of f-cells in sickle-cell disease), hypertension (early onset hypertension), rheumatoid arthritis, schizophrenia