rs7576616 chr2:155210303 T>C
- Sequence
agatttattcattccagtccatta[T/C]ttcagagaagcagagcatacttta
- ASB in cell types
- TTC-1240 (Rhabdoid tumor of the kidney)
- ASB for transcription factors
- SMCA4_HUMAN SMRC1_HUMAN REQU_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMCA4_HUMAN | -2.85 | 3.30 | 1.12 | n/a | n/a | |||
| SMRC1_HUMAN | -3.17 | 3.35 | 1.25 | n/a | n/a | |||
| REQU_HUMAN | n/a | 2.73 | 1.00 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP amyotrophic lateral sclerosis (als) age of onset, aortic valve calcium, birth weight, comorbid depressive syndrome and alcohol dependence, infant head circumference, paclitaxel-induced cytotoxicity in lymphoblastoid cell lines, sporadic creutzfeldt-jakob disease, tardive dyskinesia