rs757693 chr7:44848430 G>A
- Sequence
gctaataaggtgaagcgattgcag[G/A]cgctgtggctttcccgcccattcg
- ASB in cell types
- HEK293 (embryonic kidney) HepG2 (hepatoblastoma) GM12878 (female B-cells lymphoblastoid cell line) thymus-derived CD34- cells
- ASB for transcription factors
- RBM25_HUMAN PRDM4_HUMAN E2F1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RBM25_HUMAN | n/a | 1.05 | 6.00 | n/a | n/a | |||
| PRDM4_HUMAN | -2.99 | 3.05 | 1.00 | n/a | n/a | |||
| E2F1_HUMAN | 1.30 | 0.15 | 1.00 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP college completion, mitral annular calcium, obesity with early age of onset (age >2), total cholesterol change with statins, triglycerides change with statins
GTEx eQTL Brain_Caudate_basal_ganglia, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Muscle_Skeletal, Testis, Thyroid, Whole_Blood