rs7585857 chr2:159101914 A>C
- Sequence
gatactgccctactccttgtatgg[A/C]gacactggagagtgccggccactt
- ASB in cell types
- THP-1 (acute monocytic leukemia)
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | -0.01 | 1.86 | 1.80 | n/a | No Hit |
Items per page:
1 – 1 of 1