rs7586970 chr2:187478770 T>C
- Sequence
aagacttggtaaatatgagccgca[T/C]tcttccaaccatcatttgttcctt
- ASB in cell types
- LNCaP (prostate carcinoma)
- ASB for transcription factors
- FOXA1_HUMAN ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA1_HUMAN | 2.36 | -0.29 | 2.26 | n/a | No Hit | |||
| ANDR_HUMAN | 1.86 | -0.48 | 2.21 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP coronary artery disease (cad), ldl cholesterol, longstanding arthritis, total cholesterol, waist hip ratio
PheWAS abnormal coagulation profile, abnormal cytological, histological, immunological and dna test findings, abnormal results of function studies, acute bronchitis and bronchiolitis, adverse effects of antilipemic and antiarteriosclerotic drugs, adverse effects of hormones and synthetic substitutes, allergies, other, amblyopia, aseptic necrosis of bone, bullous dermatoses, cachexia, cellulitis and abscess of leg, cholesteatoma, choroidal degenerations, complex regional/central pain syndrome, complications of transplants and reattached limbs, contact and allergic dermatitis of eyelid, deviated nasal septum, diaphragmatic hernia, diseases of nail, diseases of spleen, disorders of choroid, duodenal ulcer, dupuytrens disease, fracture of humerus, gross hematuria, hemangioma and lymphangioma, any site, labyrinthitis, lipoprotein disorders, mitral valve stenosis and/or aortic valve stenosis, nerve plexus lesions, nonrheumatic tricuspid valve disorders, obesity, osteoarthritis, localized, osteoarthrosis, other disorders of adrenal glands, other disorders of lipoid metabolism and hyperalimentation, other specified diseases of nail, pervasive developmental disorders, pruritus and related conditions, retinal drusen, retinoschisis and retinal cysts, rosacea, second degree av block, sleep apnea, swelling of limb, toxic erythema, unequal leg length (acquired), urethral stricture (not specified as infectious), varicose veins, varicose veins of lower extremity
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Spinal_cord_cervical_c-1, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Ovary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Whole_Blood