rs7589210 chr2:64876185 T>C
- Sequence
gtggcttttcttccatccaggcag[T/C]cactaacaagaggtacagccttga
- ASB in cell types
- BIN-67 (Ovarian small cell carcinoma, hypercalcemic type)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| BIN-67 (Ovarian small cell carcinoma, hypercalcemic type) | 1.00 | 0.61 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP cystatin c in serum, ldl cholesterol change with statins, total cholesterol change with statins, triglycerides change with statins