rs75936811 chr8:9369233 T>C
- Sequence
gagcgggtatcggtgaggctgagc[T/C]ggaacgcgattagattttgtgcgt
- ASB in cell types
- foreskin keratinocyte epithelial cell of proximal tubule
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.80 | n/a | 2.33 | |||
| epithelial cell of proximal tubule | 2.24 | -2.06 | 1.00 |
Items per page:
1 – 2 of 2