rs7594660 chr2:199603871 A>G
- Sequence
gggaatcccacagcttcacatgtt[A/G]gccatgtgcgctggcggcagcggg
- ASB in cell types
- Tet21N (neuroblastoma)
- ASB for transcription factors
- TWST1_HUMAN MYCN_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TWST1_HUMAN | 2.43 | -1.78 | 1.00 | n/a | No Hit | |||
| MYCN_HUMAN | 1.77 | -1.64 | 1.00 | 0.94 | Weak Discordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP diabetic retinopathy in type 2 diabetes mellitus, homa-b, salmonella-induced pyroptosis, years of education
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid