rs76067258 chr1:183235211 G>T
- Sequence
agtttagagctgaagcgaaagtgc[G/T]taaaggttggatcctgggtgaaat
- ASB in cell types
- Kelly (neuroblastoma) ID00014 (lymphoblastoid cell, DiGeorge syndrome)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| Kelly (neuroblastoma) | 0.44 | 1.57 | 2.00 | |||
| ID00014 (lymphoblastoid cell, DiGeorge syndrome) | -1.28 | 1.78 | 1.00 |
Items per page:
1 – 2 of 2