rs760756 chr22:50192544 G>A
- Sequence
tttgtgtgctttgtggattcctcc[G/A]tctgtactgactctgtgccggtgt
- ASB in cell types
- monocyte-derived macrophages from peripheral blood
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| monocyte-derived macrophages from peripheral blood | 2.48 | n/a | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Artery_Aorta, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Liver, Lung, Muscle_Skeletal, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Whole_Blood