rs760788 chr6:11770472 C>T
- Sequence
agaggagaggggagaacagaaaag[C/T]aggcagcagacagcagggaaaggt
- ASB in cell types
- HCC1806(Squamous cell breast carcinoma, acantholytic variant)
- ASB for transcription factors
- BRD2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BRD2_HUMAN | -0.01 | 1.48 | 1.25 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, advanced age-related macular degeneration (geographic atrophy), body mass index (bmi), cleft lip, with or without cleft palate, cleft lip, with or without cleft palate, in european ancestry population, spine bone mineral density (bmd)