rs7612780 chr3:31769066 A>G
- Sequence
actgagtgccaagccccatggaaa[A/G]taagaaaggggcccttaagaagtg
- ASB in cell types
- GM02255 (Lymphoblastoid Cell Lines) GM12892 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 1.03 | 0.14 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP alcohol dependence, alcohol dependence (early age of onset), comorbid depressive syndrome and alcohol dependence, diabetic retinopathy in type 2 diabetes mellitus, eye color, ldl cholesterol, obesity with early age of onset (age >2), refractive error