rs7614776 chr3:33097052 A>G
- Sequence
ggcccagaagcagcagaaccagca[A/G]cagagggaggatgcgaaccaggaa
- ASB in cell types
- 22RV1 (prostate carcinoma) MCF10A (breast epithelial cells)
- ASB for transcription factors
- ANDR_HUMAN TEAD4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | -5.17 | 2.99 | 2.00 | n/a | No Hit | |||
| TEAD4_HUMAN | -1.91 | 2.31 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Cells_Cultured_fibroblasts, Skin_Sun_Exposed_Lower_leg, Testis