rs7619507 chr3:100492758 T>C
- Sequence
tagggacccaagtttaaaaattcc[T/C]ccccccacccaatgcgagacgtgg
- ASB in cell types
- HepG2 (hepatoblastoma) GM12878 (female B-cells lymphoblastoid cell line) BEAS-2B (bronchial epithelium)
- ASB for transcription factors
- RBM25_HUMAN GCR_HUMAN MEF2B_HUMAN ARNT_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RBM25_HUMAN | -1.14 | 2.98 | 2.00 | n/a | n/a | |||
| GCR_HUMAN | 3.02 | -3.01 | 1.00 | n/a | No Hit | |||
| MEF2B_HUMAN | 2.17 | n/a | 1.00 | n/a | No Hit | |||
| ARNT_HUMAN | 2.46 | -2.49 | 1.00 | n/a | No Hit | |||
| REQU_HUMAN | 2.27 | n/a | 1.00 | n/a | n/a |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cortex, Brain_Frontal_Cortex_BA9, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Whole_Blood