rs7621653 chr3:20468799 A>G
- Sequence
tccttcccctgctggaagcatggc[A/G]ggggagtggcggtggatttttctc
- ASB in cell types
- iPS-derived chondrocytes
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| iPS-derived chondrocytes | 1.53 | -0.30 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Nerve_Tibial, Testis, Thyroid