rs7625756 chr3:11208031 A>G
- Sequence
acgcaagagcaggatgaagaattt[A/G]aaactgtgtttgccaaactttcac
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HUVEC-C (HUVEC, umbilical vein endothelial cells) | 2.11 | -0.88 | 3.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP ldl cholesterol, ldl cholesterol change with statins, lung function, ratio of forced expiratory volume in 1 second (fev1) to forced vital capacity (fvc) (fev1/fvc) ratio percent predicted (in asthmatic participants), neuroblastoma (brain cancer), primary rhegmatogenous retinal detachment, total cholesterol change with statins