rs76367760 chr7:100852602 G>A
- Sequence
gcattgcatccccgggcgcacgtg[G/A]agctggagcagcgcaggctgggga
- ASB in cell types
- CD14+ monocytes GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- BHE40_HUMAN STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BHE40_HUMAN | n/a | 1.23 | 1.50 | 4.33 | Concordant | |||
| STAT1_HUMAN | 2.08 | -0.63 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Cerebellum, Brain_Spinal_cord_cervical_c-1, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid