rs7640968 chr3:167684656 A>C
- Sequence
gcctcaacaacccagttcatttat[A/C]ggtggaacaagttaactggccaaa
- ASB in cell types
- foreskin keratinocyte neutrophils OCI-LY7 (diffuse large B-cell lymphoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 1.36 | n/a | 1.83 | |||
| neutrophils | 1.95 | -1.29 | 1.50 | |||
| OCI-LY7 (diffuse large B-cell lymphoma) | -0.46 | 1.68 | 1.00 |
Items per page:
1 – 3 of 3