rs7651576 chr3:23743569 A>G
- Sequence
ggccccaccccccgccgcctccac[A/G]tgtcgctgtctgccccgggcaccc
- ASB in cell types
- epithelial cell of prostate 22RV1 (prostate carcinoma) bipolar neuron HEK293 (embryonic kidney)
- ASB for transcription factors
- CTCF_HUMAN ZN778_HUMAN ZFHX2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | -0.01 | 2.80 | 1.75 | 0.42 | Weak Concordant | |||
| ZN778_HUMAN | n/a | 4.23 | 2.00 | n/a | n/a | |||
| ZFHX2_HUMAN | 3.12 | n/a | 2.00 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GRASP birth weight, comorbid depressive syndrome and alcohol dependence, salmonella-induced pyroptosis