rs7651784 chr3:105835736 T>G
- Sequence
ctaattaaaattcttgacagcagt[T/G]tgagattgcagtacagcaaataaa
- ASB in cell types
- VCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| VCaP (prostate carcinoma) | 1.38 | 0.28 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Muscle_Skeletal, Testis, Thyroid, Whole_Blood