rs76654991 chr19:3683366 C>G
- Sequence
gagggaaacggggttggatggggt[C/G]aagagcccaggggcgcaggctgct
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.36 | 1.14 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Brain_Cerebellum, Cells_EBV-transformed_lymphocytes, Muscle_Skeletal, Spleen, Testis, Whole_Blood