rs7678773 chr4:31042615 C>T
- Sequence
aagcattggggaaggattagatat[C/T]gaagtcaaactcaaaaattttact
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 2.41 | -2.01 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, diabetic retinopathy in type 2 diabetes mellitus, nonsyndromic cleft lip with or without cleft palate, parkinsons disease, partial epilepsy, tetrology of fallot, years of education