rs7680647 chr4:1748760 T>C
- Sequence
tggaggggtggaacgtgtacgtcc[T/C]ggctgcccccgagctctggggacc
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.06 | 0.79 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Esophagus_Muscularis, Lung, Muscle_Skeletal, Nerve_Tibial, Pituitary, Testis, Thyroid