rs7682481 chr4:122602871 G>C
- Sequence
taggaaatgttccctgtgacacac[G/C]gtacatatattgctcatagtcaca
- ASB in cell types
- VCaP (prostate carcinoma)
- ASB for transcription factors
- HDAC1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HDAC1_HUMAN | 2.30 | 0.00 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP alopecia areata, triglycerides, type 1 diabetes, rheumatoid arthritis, crohns disease, combined case analysis, gender differentiated