rs7688 chr12:49763288 T>C
- Sequence
gccacccggcccttccttcctcat[T/C]gttgtttggtatgcgcacagttcc
- ASB in cell types
- GM19240 (B cells Lymphoblastoid Cell Lines) dermal fibroblasts
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19240 (B cells Lymphoblastoid Cell Lines) | 1.14 | -1.34 | 1.11 | |||
| dermal fibroblasts | 2.36 | -2.38 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Hippocampus, Cells_Cultured_fibroblasts, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Pituitary, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood