rs7689499 chr4:4252758 T>C
- Sequence
aggatgatctcgatctcctgacct[T/C]gtgatccgcccgcctcggcctccc
- ASB in cell types
- transverse colon 2588 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| transverse colon | -0.27 | 1.54 | 1.00 | |||
| 2588 (Lymphoblastoid Cell Lines) | -0.40 | 1.33 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Brain_Anterior_cingulate_cortex_BA24, Brain_Hypothalamus, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Muscle_Skeletal, Thyroid