rs76940618 chr1:153229572 G>A
- Sequence
atgctccatgtggagaagacaaga[G/A]tacagagatgcagcatctaacaga
- ASB in cell types
- bipolar neuron IPSC-derived bipolar neuron GM02255 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| bipolar neuron | 1.78 | -1.58 | 1.00 | |||
| IPSC-derived bipolar neuron | 1.92 | -0.36 | 1.00 | |||
| GM02255 (Lymphoblastoid Cell Lines) | 1.22 | -0.59 | 2.00 |
Items per page:
1 – 3 of 3