rs7705285 chr5:50325579 T>G
- Sequence
agtgatctttttgtagtcatttta[T/G]tttctaatttccttataaattttt
- ASB in cell types
- GM17942 (lymphoblastoid cell) hepatocytes
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM17942 (lymphoblastoid cell) | -1.91 | 2.40 | 1.00 | |||
| hepatocytes | -2.22 | 2.19 | 1.00 |
Items per page:
1 – 2 of 2