rs77137041 chr7:65006869 C>G
- Sequence
gagtgaaccctaagccttttcagg[C/G]agagcttcctccctgagctgaccc
- ASB in cell types
- macrophages form periferal blood
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 2.23 | 0.19 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Colon_Sigmoid, Heart_Left_Ventricle, Muscle_Skeletal, Pancreas, Skin_Not_Sun_Exposed_Suprapubic