rs77217932 chr18:48023997 C>T
- Sequence
ccaggagagggagccattgaatca[C/T]gttcacatttgatgactcctttca
- ASB in cell types
- foreskin keratinocyte GM12890 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 1.21 | n/a | 3.00 | |||
| GM12890 (Lymphoblastoid Cell Lines) | 1.58 | -1.20 | 1.00 |
Items per page:
1 – 2 of 2