rs7746044 chr6:76876908 T>C
- Sequence
gcaatgcctcgccctgcttcggct[T/C]gcgcacggtgcgtgcacccactgg
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) epithelial cell of prostate
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 1.59 | -0.39 | 1.05 | |||
| epithelial cell of prostate | -1.70 | 2.26 | 1.00 |
Items per page:
1 – 2 of 2