rs774855 chr3:111967226 C>T
- Sequence
tcctttccttttctaacttcccca[C/T]gtgcttcctctgtgaccttcagcc
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CTV-1 (Adult T acute lymphoblastic leukemia) | 0.37 | 1.37 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), fasting insulin, homa-b, homa-ir, ldl cholesterol change with statins, type 1 diabetes, rheumatoid arthritis, crohns disease, combined case analysis, gender differentiated