rs7754346 chr6:127516896 T>A
- Sequence
agggtggcgctgtctccatctcac[T/A]ccacctcagcaaaatgacggatct
- ASB in cell types
- GM12890 (Lymphoblastoid Cell Lines) RWPE1 (prostate epithelial cells) MCF10CA1a (breast metastatic epithelial cells) Kelly (neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12890 (Lymphoblastoid Cell Lines) | 0.83 | -0.44 | 1.00 | |||
| RWPE1 (prostate epithelial cells) | 2.73 | -2.47 | 1.00 | |||
| MCF10CA1a (breast metastatic epithelial cells) | -1.64 | 1.94 | 1.00 | |||
| Kelly (neuroblastoma) | 1.00 | 1.02 | 1.00 |
Items per page:
1 – 4 of 4