rs7764238 chr6:119303596 C>T
- Sequence
ttcaccccatgaacatttacgtaa[C/T]tgtatacttggatctaatatgtgc
- ASB in cell types
- TTC-1240 (Rhabdoid tumor of the kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| TTC-1240 (Rhabdoid tumor of the kidney) | n/a | 2.08 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP birth weight, hdl cholesterol change with statins, homa-b, ldl cholesterol change with statins, major depressive disorder (broad definition), major depressive disorder (broad definition) (females), major depressive disorder (narrow definition), major depressive disorder (narrow definition) (females), major depressive disorder (narrow definition) (males), recurrent early onset major depressive disorder, recurrent early onset major depressive disorder (females), total cholesterol change with statins, years of education