rs77667547 chr15:68230105 G>A
- Sequence
aggcaggactggagacctgcacgt[G/A]tagcacccgcgtggtgcagcacgt
- ASB in cell types
- P493-6 (B-cell lymphoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| P493-6 (B-cell lymphoma) | 1.76 | -0.70 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Skin_Sun_Exposed_Lower_leg