rs776696 chr15:42057149 A>G
- Sequence
aggctacccggatcgtccagcgcg[A/G]catggagtctgtgtgtcctcacca
- ASB in cell types
- GM02255 (Lymphoblastoid Cell Lines) heart left ventricle THP-1 (acute monocytic leukemia) ID00014 (lymphoblastoid cell, DiGeorge syndrome)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02255 (Lymphoblastoid Cell Lines) | 1.00 | -0.69 | 1.00 | |||
| heart left ventricle | -1.27 | 1.27 | 1.00 | |||
| THP-1 (acute monocytic leukemia) | 0.54 | 0.99 | 1.03 | |||
| ID00014 (lymphoblastoid cell, DiGeorge syndrome) | 1.44 | -1.26 | 1.00 |
Items per page:
1 – 4 of 4