rs7767581 chr6:31272078 C>G
- Sequence
gggcgccatgacccgcatctcggc[C/G]tctggggagaatgtgagtccgggt
- ASB in cell types
- LNCaP (prostate carcinoma) CUTLL1 (T-cell lymphoblastic lymphoma 1) LNCaP C4-2B (prostate carcinoma) GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- TBP_HUMAN UBP7_HUMAN ZFX_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TBP_HUMAN | 2.63 | -4.41 | 1.33 | n/a | No Hit | |||
| UBP7_HUMAN | 2.74 | n/a | 1.00 | n/a | n/a | |||
| ZFX_HUMAN | 2.18 | -1.69 | 1.00 | -4.51 | Concordant | |||
| CTCF_HUMAN | 1.17 | 0.35 | 1.23 | n/a | No Hit |
Items per page:
1 – 4 of 4
Motif analysis
Genetic associations
GRASP body mass index (bmi), cystatin c in serum, height, infant head circumference, ldl cholesterol, rheumatoid arthritis, rheumatoid arthritis (acpa-positive), sarcoidosis, total cholesterol, triglycerides, urinary albumin-to-creatinine ratio, waist hip ratio