rs7774434 chr6:32689801 T>C
- Sequence
cctgtctctggactcaactcaaca[T/C]cccatgtcctcgctcagactatat
- ASB in cell types
- GM19239 (male B-cells lymphoblastoid cell line)
- ASB for transcription factors
- TBX21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TBX21_HUMAN | -0.28 | 1.45 | 1.17 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP antibody titer to hepatitis b vaccination, body mass index (bmi), breast cancer, coronary artery disease (cad), cystatin c in serum, hdl cholesterol, hepatitis b virus (hbv)-related hepatocellular carcinoma, hla-dqa1 cis-gene expression, hla-drb1 cis-gene expression, hla-drb4 cis-gene expression, joint damage severity in rheumatoid arthritis, mitral annular calcium, parkinsons disease, parkinsons disease (pd), primary biliary cirrhosis, rheumatoid arthritis, rheumatoid arthritis (acpa-positive), serum creatinine, total cholesterol, triglycerides, type 1 diabetes, waist hip ratio
PheWAS abnormal results of function study of liver, acute sinusitis, allergic rhinitis, arteritis nos, atherosclerosis of native arteries of the extremities with ulceration or gangrene, blindness and low vision, bullous dermatoses, cachexia, calcaneal spur, exostosis nos, calculus of kidney, calculus of ureter, cellulitis and abscess of leg, cholangitis, chronic pharyngitis and nasopharyngitis, chronic sinusitis, chronic venous insufficiency, claw toe, complex regional/central pain syndrome, concussion, conjunctivitis, infectious, cornea replaced by transplant, cysts of the jaws, derangement of joint, non-traumatic, dermatosis nos, diplopia and disorders of binocular vision, discoid lupus erythematosus, disorders of external ear, disorders of sweat glands, disorders of the autonomic nervous system, eosinophilia, erythematous conditions, gastroparesis, generalized hyperhidrosis, hallux rigidus, heart valve replaced, infestation, inguinal hernia, insomnia, intestinal infection, iron metabolism disorder, keratoconjunctivitis, noninfectious, labyrinthitis, lupus erythematosus, macular degeneration, wet, multiple sclerosis, muscular wasting and disuse atrophy, myalgia and myositis nos, myocardial infarction, obstruction of bile duct, other diseases of the teeth and supporting structures, other disorders of adrenal glands, other disorders of thyroid, other local infections of skin and subcutaneous tissue, other specified erythematous conditions, other specified gastritis, other upper respiratory disease, pericarditis, peripheral autonomic neuropathy, peripheral or central vertigo, polyarteritis nodosa and allied conditions, polycythemia vera, secondary, primary thrombocytopenia, retinal hemorrhage/ischemia, retinoschisis and retinal cysts, rheumatic fever / chorea, rheumatoid arthritis, rheumatoid arthritis & related inflammatory polyarthropathies, sarcoidosis, seborrhea, secondary malignant neoplasm of digestive systems, sleep disorders, spondylosis with myelopathy, thyrotoxicosis, type 1 diabetes, type 1 diabetic ketoacidosis, type 1 diabetic neuropathy, urinary calculus, vitamin b-complex deficiencies, vitamin b12 deficiency anemia, vitamin deficiency
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cortex, Brain_Frontal_Cortex_BA9, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Kidney_Cortex, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Vagina, Whole_Blood