rs77757573 chr7:6323190 G>T
- Sequence
ttgtggtcaacgcgaacctcacgg[G/T]cacagccccggggctttcttccca
- ASB in cell types
- neutrophils from periferal blood BJ (fibroblasts)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neutrophils from periferal blood | 2.96 | -0.24 | 2.00 | |||
| BJ (fibroblasts) | 2.27 | -1.79 | 1.00 |
Items per page:
1 – 2 of 2