rs77760630 chr10:102917933 C>A
- Sequence
tagtccaaacctggccggtccagg[C/A]tccgggatctactacaggggcccc
- ASB in cell types
- breast tumor GM12878 (female B-cells lymphoblastoid cell line) 22RV1 (prostate carcinoma) epithelial cell of prostate
- ASB for transcription factors
- ANDR_HUMAN ESR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 3.12 | -5.64 | 2.00 | n/a | No Hit | |||
| ESR1_HUMAN | 2.93 | -5.44 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Cells_Cultured_fibroblasts, Esophagus_Mucosa, Pancreas, Skin_Sun_Exposed_Lower_leg, Whole_Blood