rs77775520 chr2:175919196 C>T
- Sequence
tttggaagcagaagggtcaagacg[C/T]cagtggcaaggttagatgtcagca
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- COT1_HUMAN KDM1A_HUMAN NR2C1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| COT1_HUMAN | -2.84 | 3.15 | 1.00 | n/a | No Hit | |||
| KDM1A_HUMAN | -0.42 | 2.36 | 1.00 | n/a | n/a | |||
| NR2C1_HUMAN | -1.10 | 2.63 | 1.00 | 4.26 | Concordant |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Spleen, Thyroid, Whole_Blood