rs7778803 chr7:46220327 A>G
- Sequence
aggtggaggcagagccaacgtggc[A/G]cattcctgtgtctcatttcaacct
- ASB in cell types
- foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 1.34 | -0.82 | 1.17 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), birth weight, infant head circumference, prop taste detection threshold, schizophrenia