rs7781115 chr7:4745185 A>G
- Sequence
ctgcctgcaaggctgtcccctccc[A/G]gtgccgccccgcccccgcggtgcc
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) CD34+ hematopoietic stem cells
- ASB for transcription factors
- RBM25_HUMAN TIF1B_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RBM25_HUMAN | 0.72 | 3.13 | 1.00 | n/a | n/a | |||
| TIF1B_HUMAN | 2.48 | n/a | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2