rs7801169 chr7:56093080 A>G
- Sequence
gcatggagcccagtctccgggcgg[A/G]aggtgggggacctctggtggaggg
- ASB in cell types
- gastroesophageal sphincter RH4 (alveolar rhabdomyosarcoma) adrenal gland thoracic aorta
- ASB for transcription factors
- CTCF_HUMAN RAD21_HUMAN CENPA_HUMAN CREB1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 2.31 | 0.74 | 1.44 | -0.24 | Weak Concordant | |||
| RAD21_HUMAN | 2.65 | 2.11 | 1.22 | n/a | n/a | |||
| CENPA_HUMAN | 3.17 | -0.33 | 1.67 | n/a | n/a | |||
| CREB1_HUMAN | 2.17 | -2.16 | 1.00 | n/a | No Hit |
Items per page:
1 – 4 of 4
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Whole_Blood