rs7802953 chr7:131057202 C>T
- Sequence
tcctttctgctagtttggctccag[C/T]gctcagcacatgcacttcccaagt
- ASB in cell types
- breast tumor HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| breast tumor | -1.79 | 2.73 | 2.00 | |||
| HepG2 (hepatoblastoma) | 0.74 | 0.52 | 1.15 |
Items per page:
1 – 2 of 2