rs78087483 chr3:159158342 G>T
- Sequence
gccctgtaggaggcagaacaatac[G/T]tccttgagaaagtggaaagttctt
- ASB in cell types
- GM19193 (female B-cells Lymphoblastoid Cell Lines) GM17942 (lymphoblastoid cell) 2588 (Lymphoblastoid Cell Lines) GM18505 (female B-cells Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | -1.60 | 3.10 | 1.60 | n/a | No Hit | |||
| STAG1_HUMAN | -2.66 | 2.55 | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2