rs7809791 chr7:26117615 G>C
- Sequence
tgggactgaggatgacaacccccc[G/C]catcagcatgtgtgcacataagag
- ASB in cell types
- GM18486 (Lymphoblastoid Cell Lines) GM02610 (Lymphoblastoid Cell Lines) GM12892 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18486 (Lymphoblastoid Cell Lines) | 2.41 | -2.23 | 1.00 | |||
| GM02610 (Lymphoblastoid Cell Lines) | -0.41 | 1.77 | 1.00 | |||
| GM12892 (female B-cells lymphoblastoid cell line) | -1.07 | 1.67 | 1.00 |
Items per page:
1 – 3 of 3