rs7831515 chr8:125120574 C>T
- Sequence
ctgatgtggtaaactagtttctta[C/T]gatattgggcaagccagaggttaa
- ASB in cell types
- GM23248
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM23248 | 1.69 | -1.39 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), body mass index (bmi) (max measurement), comorbid depressive syndrome and alcohol dependence, hdl cholesterol, height, ldl cholesterol change with statins, maternal transmission distortion, stabilized warfarin dose, triglycerides
GTEx eQTL Esophagus_Mucosa, Lung, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis