rs78364551 chr5:10284172 G>A
- Sequence
gcagctcacgcactacacaacagc[G/A]gccagaaggtggcgccggggaggc
- ASB in cell types
- HeLa (cervical adenocarcinoma) KB (cervical adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HeLa (cervical adenocarcinoma) | n/a | 1.73 | 6.00 | |||
| KB (cervical adenocarcinoma) | n/a | 2.19 | 6.00 |
Items per page:
1 – 2 of 2